![subject](/tpl/images/cats/biologiya.png)
Biology, 11.11.2019 21:31 logangiggles02
Clonal selection clonal selection describes the proliferation of b and t lymphocytes after they have been activated by an antigen. requires the presence and activation of complement. determines the pool of mature leukocytes that will be stimulated by macrophages. requires the activation of natural killer cells.
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:30, haileyw123
Ras is a g-protein that is activated when a growth factor attaches to egfr. its activation results in the replacement of a gdp molecule with a gtp molecule, thus allowing a signal transduction pathway to be activated. considering the signal pathway illustrated on this page, what is one potential outcome of a mutation in the ras gene that leads to ras protein hyperactivity. be specific.
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:00, Brooke7644
In trying to determine whether dna or protein is the genetic material, hershey and chase made use of which of the following facts? a) dna contains sulfur, whereas protein does not. b) dna contains phosphorus, whereas protein does not. c) dna contains nitrogen, whereas protein does not. d) dna contains purines, whereas protein includes pyrimidines.
Answers: 3
![image](/tpl/images/cats/biologiya.png)
You know the right answer?
Clonal selection clonal selection describes the proliferation of b and t lymphocytes after they have...
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
Mathematics, 22.02.2021 05:30
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/himiya.png)
![Konu](/tpl/images/cats/istoriya.png)
History, 22.02.2021 05:30
![Konu](/tpl/images/cats/fizika.png)
![Konu](/tpl/images/cats/himiya.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/himiya.png)
Chemistry, 22.02.2021 05:30
![Konu](/tpl/images/cats/istoriya.png)