subject
Biology, 04.11.2019 21:31 skgoldsmith

Explain why ecological equivalents do not share the same niche.

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 00:20, sam9350
The buildup of sediments where a river empties into a slow-moving or nonmoving body of water is known as a/an
Answers: 1
image
Biology, 22.06.2019 02:00, franksjamia
Which two factors contributed to creating a global culture? the creation of the united nations improvement in telecommunications health issues such as the ebola virus increased opportunities for global travel
Answers: 3
image
Biology, 22.06.2019 05:00, Goldenstate32
2. if someone had the list of traits you provided in question 1, do you think he or she would be able to find you in a group of 1000 people? why or why not? if not, what other information encoded in your genes might distinguish you from the others in the group? what are other traits that are encoded for by dna?
Answers: 3
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Explain why ecological equivalents do not share the same niche....

Questions in other subjects: