subject
Biology, 18.10.2019 17:30 kharmaculpepper

Why are living organisms classified into different kingdoms

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 10:30, steves9994
Eutrophication caused by human nutrient pollution.
Answers: 1
image
Biology, 22.06.2019 11:30, natbod133
How dose plate tectonics effect climate
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:00, NotYourStudent
What is the one part of the nucleotide  that differs among the other different nucle  tides?
Answers: 1
You know the right answer?
Why are living organisms classified into different kingdoms...

Questions in other subjects:

Konu
Mathematics, 01.12.2020 19:30
Konu
Mathematics, 01.12.2020 19:30
Konu
Chemistry, 01.12.2020 19:30