Asap! underline the dependent variable and bold the independent variable for each.
1. the height of bean plants depends on the amount of water they recieve.
2. the higher the temerature of the air in the oven, the faster a cake will bake.
3. lemon trees receiving the most water produced the most lemons
4. an investigation found that more bushels of potatoes were produced when the soil was fertalized more.
5. the amount of pollution produces by cars was measured for cars using gasoline containing different amounts of lead.

What is the compliment dna strand to the following sequence: ttgactaggcta

Which of these is a provisioning service people get from the ocean

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?