Biology, 04.01.2020 00:31 miarobless12389
In a rare southern lizard species, individuals with (aa) genotype do not live to a reproductive age. the gene pool of the lizard population is affected because this allele (a).
a. favours migration
b. produces new gene combinations
c. increases genetic diversity
d. decreases in frequency
Answers: 2
Biology, 21.06.2019 15:30, tpenubothu24
Which prevent errors in dna replication? a. helicase enzyme checks the dna for errors. b. each base can attach to only one other type of base. c. ribosome enzymes prevent errors from happening. d. dna contains no complementary base pairs.
Answers: 1
Biology, 22.06.2019 11:30, aaron0828
2. cheryl hears a new song on the radio every day during the week on her commute to work. surprisingly, when the song comes on at a party on saturday night, she knows most of the words without trying. describe the three ways that we use cognition to learn without reinforcement. which type of cognitive learning without reinforcement best explains how cheryl knew the song lyrics? explain your answer.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
In a rare southern lizard species, individuals with (aa) genotype do not live to a reproductive age....
Chemistry, 17.12.2019 05:31