In yellowstone national park, there are dozens of spectacular thermal pools filled with very hot water that rises from deep underground. in each thermal pool, there is a community of microbes that create the spectacular colors we can see in them. these microbes are very temperature sensitive. between 1990 and 1997, the temperature in this pool was 89 degrees c. in 1997, a small, cool surface stream changed course and flowed into the pool, lowering the temperature by 7 degrees c. this significantly lowered the allele frequency of the heat tolerant allele. after 2 years, the stream changed course again and the temperature in the pool returned to its original 89 degrees, returning the allele frequency of the heat tolerant allele to its pre-1990 level. this story illustrate
Answers: 2
Biology, 22.06.2019 05:40, mustachbrah
When new rock is added to an oceanic ridge, the magnetized strips on either side of the ridge are evidence of sea-floor spreading. this is because the rocks on the two sides of the ridge o are equal in width and in polarity are polar opposites oare magnetized vary in width but are equal in polarity
Answers: 3
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
In yellowstone national park, there are dozens of spectacular thermal pools filled with very hot wat...
History, 01.01.2020 22:31
Social Studies, 01.01.2020 22:31
Mathematics, 01.01.2020 22:31
History, 01.01.2020 22:31
Social Studies, 01.01.2020 22:31
Computers and Technology, 01.01.2020 22:31