Biology, 17.09.2019 03:20 mrme41

The primary structure of proteins is the the primary structure contains the information necessary for the formation of secondary structure, including the and the secondary structure of proteins is stabilized by the formation of bonds.

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 03:30, pineapplefun

The human genome project is devoted to mapping the general dna sequence of our species. this could lead to the development of new medicines, as well as the possibility of using gene therapy to treat certain diseases. however, there are some ethical issues surrounding the mapping of individual genomes. one concern is a) that your genes may change over time, making the project useless. b) that insurance companies could discriminate based on genetic make-up. c) that since this has never been done before, we should probably not do it now. d) that sequencing our individual genomes is so expensive, it is a counter-productive strategy.

Answers: 1

continue

Biology, 22.06.2019 05:30, tiffanybrown703

Identify the composition of oceanic and continental crystal rocks. in a model of earth’s interior, where would these rocks appear?

Answers: 2

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

Biology, 22.06.2019 16:50, domdom71

When is your breathing likely to speed up? a. when your white blood cells increase b. when your cells need more energy c. when your heart cells need more carbon dioxide d. when your blood cells have too much oxygen

Answers: 1

continue

You know the right answer?

The primary structure of proteins is the the primary structure contains the information necessary f...