Free !
some major concerns of physical science are
- pollution, mineral location, and new energy sources
- space exploration and national defense
- microbiology advancements and cloning procedures

The negative impacts of nonnative species generally outweigh the positive impacts

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Protein and polypeptide sequences can be determined by first partially hydrolyzing the protein or polypeptide followed by amino acid sequencing of the fragment pieces using the chemical degradation process known as edman degradation. determine the sequence of the initial (18-amino acid) polypeptide that produces the following five partial sequences after hydrolysis and edman degradation.