subject
Biology, 30.06.2019 23:10 annacurry2019

Carbohydrates are important in the body because they contribute to the body's ability to a. produce atp. b. regulate temperature. c. produce amino acids. d. absorb water.

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 05:00, cecem58
Jason adds the antibiotic penicillin to a bacterial culture. the bacteria develop genetic modifications in their genome, which gives them resistance to the antibiotic penicillin. what caused this genetic modification?
Answers: 2
image
Biology, 22.06.2019 09:00, keesbre
How does photosynthesis show the conservation of mass and energy?
Answers: 1
image
Biology, 22.06.2019 10:00, mythic61
Students commonly confuse saccharomyces cerevisiae and staphylococcus aureus when viewed on a microscope slide how could you microscopically differentiate
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Carbohydrates are important in the body because they contribute to the body's ability to a. produce...

Questions in other subjects:

Konu
Mathematics, 06.01.2021 04:50