subject
Biology, 29.08.2019 21:00 1234567890lknn

If the weather forecaster tells you that the pressure is falling, what is the air density doing? uncertain increasing decreasing remaining constant

ansver
Answers: 2

Other questions on the subject: Biology

image
Biology, 21.06.2019 20:30, chozz2783
Match the descriptions / definitions with the term they best describe 1. three dimensional relationship of the different polypeptide chains in a multisubunit protein or protein complex 2. common folding pattern in proteins in which a linear sequence of amino acids folds into a right-handed coil stabilized by internal hydrogen-bonding between polypeptide backbone atoms. 3. the amino acid sequence of a protein 4. a region on the surface of a protein that can interact with another molecule through noncovalent bonding. 5. three-dimensional arrangement of alpha-helices and beta-sheets within a single polypeptide, typically stabilized by a variety of noncovalent bonds, including ionic and hydrogen bonds, and nonpolar interactions / hydrophobic force. 6. the chain of repeating carbon and nitrogen atoms, linked by peptide bonds, in a protein. 7. common structural motif in proteins in which different sections of the polypeptide chain run alongside each other and are joined together by hydrogen bonding between atoms of the polypeptide backbone. 8. portion of a polypeptide chain that has a discrete tertiary structure of its own and can often fold independently of the rest of the chain 9. regular local folding patterns in a protein, including alpha-helix and beta-sheet a. primary structure b. beta-sheet c. protein d. coiled-coil e. polypeptide backbone f. secondary structure g. side chain h. tertiary structure i. binding site j. alpha-helix k. quaternary structure l. protein domain
Answers: 2
image
Biology, 22.06.2019 06:00, tiffanibell71
Which kingdom includes some organisms that have no nucleus and can live in an environment with an extremely high salt content
Answers: 1
image
Biology, 22.06.2019 09:00, noeminm105
Which two criteria must be met before scientist can use radiocarbon dating? explain your answer
Answers: 3
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
If the weather forecaster tells you that the pressure is falling, what is the air density doing? un...

Questions in other subjects:

Konu
Mathematics, 03.09.2019 04:10
Konu
Biology, 03.09.2019 04:10
Konu
Chemistry, 03.09.2019 04:10
Konu
Chemistry, 03.09.2019 04:10