(will mark brainliest, i need urgently) what is the dna sequence, resulting mrna sequence, complementary trna sequence, and resulting amino acid sequence

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

measuring light intensity

light meters can be used to measure light intensity. the meter is held at the soil surface and pointed in the direction of the maximum light intensity, and then the meter is read.

errors can be made when measuring light intensity by accidentally shading the light meter. the reliability of the results can be checked by taking many samples.