a. chlorofluorocarbons (cfcs).
![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:30, lambobacon9467
Human genes only differ by less than percent. a. 1 b. 6 c. 11 d. 16
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:30, pinklover2002
Which of the following statements is accurate about evolution? question 10 options: natural selection only eliminates odd individuals. evolution means that a population never has changes in its genetic frequencies. mutations are always harmful. evolution means that a population undergoes changes in its gene frequencies over time.
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
4) all of the following are sources of air pollution, except
a. chlorofluorocarbons (cfcs).
a. chlorofluorocarbons (cfcs).
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
Mathematics, 24.02.2020 19:47
![Konu](/tpl/images/cats/health.png)
Health, 24.02.2020 19:47
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/informatica.png)
![Konu](/tpl/images/cats/informatica.png)
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/health.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)