subject
Biology, 25.08.2019 09:10 bri1334

Trees obtain carbon from
a. decaying organisms
b. sunlight
c. the atmosphere
d. none of the above

ansver
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 02:30, dimpleschris101
Suppose you have monohybrid pea plants in your garden and find that they produce round seed to wrinkled seeds in the ratio of 3: 1. if the allele are designated (r & r) receptively. what is the probable genotypes of the round seeds which produced f 1 ? rr & rr rr only rr & rr rr only rr only
Answers: 1
image
Biology, 22.06.2019 07:30, joe7977
In this assignment, you will analyze an example of speciation by researching the finches of the galapagos islands. then you will answer questions to construct explanations and draw conclusions based on the information you gather. someone plz !
Answers: 3
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:10, lily1482
Which of the following is likely not involved in this example of ecological succession? a) the rotting remains of plants add to the fertility of the soil. b)the soil becomes so fertile that eel grass is replaced by other plant species. c) the roots from plants stabilize the sediment, keeping it in place. d) the concentration of salt becomes so high that all plant life is destroyed.
Answers: 1