![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:30, jcrowley9362
Plz ! a frog has a genetic mutation in skin cells that causes part of its skin to turn orange the frog will not pass this genetic mutation onto its offspring because, a. the offspring will inherit skin cells from the other parent. b. mutated skin cells cannot divide and produce daughter skin cells. c. skin cells do not contribute genetic material to sex cells. d. parents do not contribute genetic material to their offspring.
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00, thomasalmo2014
Which best describes the scientific method? a. a path of clearly defined steps that must be followed in a particular order b. a possible answer to a scientific question based on knowledge or research c. the recipe for how to conduct an experiment that must be followed precisely d. the process of hypothesis and testing through which scientific inquiry occurs
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:10, hcoulter15
Which of the following best describes the purpose of the parathyroid hormone? a. it decreases the blood calcium level and decreases blood phosphorus level. b. it decreases the blood calcium level and increases the blood phosphorus level. c. it increases the blood calcium level and increases blood phosphorus level. d. it increases the blood calcium level and decreases blood phosphorus level.
Answers: 2
You know the right answer?
What are several instances of naturally occurring events that can cause the salinity of ocean water...
Questions in other subjects:
![Konu](/tpl/images/cats/es.png)
![Konu](/tpl/images/cats/istoriya.png)
History, 30.12.2019 11:31
![Konu](/tpl/images/cats/mat.png)
Mathematics, 30.12.2019 11:31
![Konu](/tpl/images/cats/mat.png)
Mathematics, 30.12.2019 11:31
![Konu](/tpl/images/cats/himiya.png)
Chemistry, 30.12.2019 11:31
![Konu](/tpl/images/cats/health.png)
![Konu](/tpl/images/cats/himiya.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 30.12.2019 11:31
![Konu](/tpl/images/cats/mat.png)
Mathematics, 30.12.2019 11:31
![Konu](/tpl/images/cats/mat.png)
Mathematics, 30.12.2019 11:31