![subject](/tpl/images/cats/biologiya.png)
Biology, 04.07.2019 20:30 NNopeNNopeNNope
What organism is primarily responsible for nitrogen fixation
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:40, alexdziob01
Which scientific design has both practical limitations and limitations due to scale? studying the effect of bleach on the growth of mold spores exposing cultures of duckweed to different intensities of light observing the replication of dna molecules with a hand lens using colored marbles to model a cross between two colors of rabbits
Answers: 2
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What organism is primarily responsible for nitrogen fixation...
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 24.11.2019 22:31
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/obshestvoznanie.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 24.11.2019 22:31
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/health.png)
Health, 24.11.2019 22:31
![Konu](/tpl/images/cats/mat.png)
Mathematics, 24.11.2019 22:31
![Konu](/tpl/images/cats/mat.png)
Mathematics, 24.11.2019 22:31