subject
Biology, 04.07.2019 21:00 mayavue99251

What type of biomolecule does photosynthesis make to store chemical energy?

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 05:00, mydoggy152
Penelope studies how the structure and function of the nervous system is related to behavior. she is a psychologist
Answers: 1
image
Biology, 22.06.2019 11:10, tiannahwlit
Look at the photo of the leaf, which term best describes this leaf ? a-simple. b-parallel. c-lobed. d-tooth.
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 15:40, yourfreeshoppep3u91x
Which kind of mutation has occurred when the codon for an amino acid is changed to a stop codon? a. a silent mutation b. a missense mutation c. a frameshift mutation d. a nonsense mutation
Answers: 1
You know the right answer?
What type of biomolecule does photosynthesis make to store chemical energy?...

Questions in other subjects:

Konu
Social Studies, 09.09.2021 15:50
Konu
Mathematics, 09.09.2021 15:50