Which of the following is an example of natural selection? a. to produce a more desirable fruit, a farmer crosses a tree that produces sweet oranges with a tree that produces large oranges. b. cricket frogs prefer to sleep during the day, while red-eyed tree frogs prefer to sleep during the night. c. pesticides are sprayed in a field, resulting in an increase in crop growth and a decrease in insect population. d. rabbits with a mutation for longer, thicker fur survive an unusually cold winter, while many normal rabbits do not survive.

Compare the composition of the moon's surface with the composition of the earth's surface.

Consider the following reaction: 2h2 + o2 —> 2h2o a) what are the reactants in this reaction? b) what are the products in this reaction? c) how many molecules of oxygen are used in this reaction?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?