Biology, 11.07.2019 21:00 anaishindsp07emm
Amino acids are seen in as are needed to create dna.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:00, tatedason33741
Which characteristic should describe all evidence collected by a scientist? true obvious objective subjective
Answers: 1
Biology, 22.06.2019 18:30, jacksolo
Abeaker of water was heated and then placed on a bench in the laboratory. the water cooled until it was the same temperature as the air in the laboratory. which of these explains the mechanism by which the water cooled? a. heat energy was transferred from the water to the air. b. water molecules from the water formed warm water currents. c. the water molecules absorbed energy from the molecules in the air. d. the water released radiation until it contained no heat energy.
Answers: 1
Amino acids are seen in as are needed to create dna....
Mathematics, 21.10.2020 07:01
Engineering, 21.10.2020 07:01
Mathematics, 21.10.2020 07:01
Mathematics, 21.10.2020 07:01
Chemistry, 21.10.2020 07:01
Biology, 21.10.2020 07:01
Mathematics, 21.10.2020 07:01