subject
Biology, 17.07.2019 08:00 rah45

If you have 5 liters of blood and cellular elements account for 40% of your blood volume, what is your total plasma volume?

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 20:30, adrianawalker16
Describe at least 2 abiotic and two biotic factors found in the desert biome how do these abiotic factors interact with the biotic factors
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:30, rockinrosh12
La glucosa es el nutriente mas utilizado por las celulas en la respiracion celular en esta ocurre 4 fenomenos cuales son
Answers: 2
image
Biology, 22.06.2019 14:20, Aliyah2020
First idea: suddenly, women were leaving their homes to cycle and socialize on country roads and city streets. —wheels of change, sue macy second idea: it was not a stretch for some cyclists to see the possibility of a larger role for women in the world. —wheels of change, sue macy what type of graphic organizer would best represent the connection between these two ideas? 1) a t-chart that separates ideas into two different categories 2) a chronology that shows 3) a sequence of several events a cause-and-effect graphic that shows how one idea led to another 4)a problem-solution graphic that presents a problem and a solution to the problem
Answers: 2
You know the right answer?
If you have 5 liters of blood and cellular elements account for 40% of your blood volume, what is yo...

Questions in other subjects: