subject
Biology, 19.07.2019 20:00 putaprincess16

3why might a horticulturist not want a plant to reproduce sexually by seeds

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 23:00, reggie1127
Seen in some gram-positive bacilli, occurs when only the inner portion of a cell wall is deposited across the dividing cell. this new cross wall puts tension on the outer layer of the old cell wall. eventually, the outer wall breaks at its weakest point with a snapping movement that tears it most of the way around. the daughter cells can then remain hanging together almost side by side being held by a small remnant of the original outer wall. choose from the following statements the ones that correctly discuss reproduction using binary fission in a bacterial cell. select all that apply. view available hint(s) select all that apply. due to the stretching of the cytoplasmic membrane, both cells will contain a complete genome. each daughter cell will contain an equal number of organelles. the daughter cell will be a permanently smaller copy of the mother cell but will contain a complete genome. each daughter cell is an exact copy of the other, both genetically and morphologically
Answers: 1
image
Biology, 22.06.2019 11:30, raiindrxp
In a population that is in hardy-weinberg equilibrium, there are two possible alleles for a certain gene, a and a. if the frequency of allele a is 0.4, what fraction of the population is heterozygous? a. 0.40 b. 0.60 c. 0.16 d. 0.48
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:30, lizredrose5
Do plant cells perform cellular respiration?
Answers: 1
You know the right answer?
3why might a horticulturist not want a plant to reproduce sexually by seeds...

Questions in other subjects:

Konu
Mathematics, 26.09.2019 13:30
Konu
Mathematics, 26.09.2019 13:30